Products
- Anti-Obesity Compound Library
- GPCR/G Protein-Targeted Compounds
- Immunology/Inflammation-Targeted Compounds
- JAK/STAT-Targeted Compounds
- MAPK-Targeted Compounds
- Membrane Transporter/Ion Channel-Targeted Compounds
- Metabolism-Targeted Compounds
- NF-κB-Targeted Compounds
- Microbiology/Virology-Targeted Compounds
- Neuronal Signaling-Targeted Compounds
- PI3K/Akt/mTOR-Targeted Compounds
- Oxidation-reduction-Targeted Compounds
- Proteases/Proteasome-Targeted Compounds
- Stem Cells/Wnt-Targeted Compounds
- Tyrosine Kinase/Adaptors-Targeted Compounds
- Ubiquitin-Targeted Compounds
Online Inquiry
LipoKnoxa™ Human GHRL shRNA Lentiviral Particle (Silencing)
Cat. No.:
V0126XX428
Species:
Human
Target Gene:
GHRL
Vector System:
Lentiviral
Modulation Type:
Silencing (shRNA)
SPECIFIC INQUIRY
Add to basket
| Sub Cat. No. | TargetSeq | Region | Inquiry |
|---|---|---|---|
| V0126XX428-1 | GCAGAGAAAGGAGTCGAAGAA | CDS | Inquiry |
| V0126XX428-2 | ACCAGAGAGTCCAGCAGAGAA | CDS | Inquiry |
| V0126XX428-3 | GGAAGTTTCTTCAGGACATCC | CDS | Inquiry |
| V0126XX428-4 | Other | Inquiry |
Product Overview
Description:
LipoKnoxa™ Human GHRL shRNA Lentiviral Particle (Silencing) focuses on the stable knockdown of the ghrelin gene, the primary "hunger hormone." Utilizing an advanced RNAi framework that includes both U6 and miR30-based systems, this product allows for the long-term study of appetite initiation in endocrine cell models. Each preparation is subjected to exhaustive quality control, covering functional titer and microbial purity, providing a secure and high-performing gene-silencing solution for gut-brain axis research.
Production Cell Line:
HEK293T
Promoter:
U6; CMV; EF1α; CAG; UBC
Product Availability:
Produced Upon Order
Specification
Titer Test:
qPCR
Insert Verification:
Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.
Sterility Test:
Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.
Mycoplasma Test:
Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.
Other QC:
Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.
Storage:
Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.
Stability:
Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.
Shipping Condition:
Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.
Handling Notes:
Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.
Intended Use:
This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer:
We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.
Target Profile
Gene Name:
GHRL
Full Name:
Ghrelin and obestatin prepropeptide
Gene Symbol:
MTLRP
Gene ID:
51738
RefSeq ID-1:
NP_001128413.1
RefSeq ID-2:
NM_001134941.3
Summary:
The GHRL gene dictates the synthesis of a preproprotein that undergoes cleavage to release two hormones: ghrelin and obestatin. Ghrelin is known as the "hunger hormone," serving as a potent appetite stimulant secreted when the stomach is empty. It signals energy deficit by binding to the growth hormone secretagogue receptor (GHSR), initiating a cascade that promotes food-seeking behavior and growth hormone release. While obestatin was initially proposed as a satiety agent, current research points toward its involvement in regulating adipocyte function and glucose metabolism. GHRL is a critical component of the gut-brain axis controlling energy homeostasis and reward pathways.