LipoKnoxa™ Human ESRRA shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX586-1	GCAGAGCAATAACACTATATT	3' UTR	Inquiry
V0126XX586-2	TCGCTCCTCCTCTCATCATTT	3' UTR	Inquiry
V0126XX586-3	GAGAGGAGTATGTTCTACTAA	CDS	Inquiry
V0126XX586-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human ESRRA shRNA Lentiviral Particle (Silencing) provides a specialized solution for silencing ESRRA, a key regulator of mitochondrial biogenesis and fat oxidation. Developed through an advanced RNAi platform with a choice of U6 or miR30-based systems, this tool enables in-depth thermogenesis and metabolic flexibility analysis in brown or white adipocytes. Our lentiviral particles support the flexible selection of reporter genes and undergo total quality control screening for functional titer and sterility to ensure consistent and reliable performance.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: ESRRA

Full Name: Estrogen related receptor alpha

Gene Symbol: ERR1; ERRa; ESRL1; NR3B1; ERRalpha

Gene ID: 2101

RefSeq ID-1: NP_001269379.1

RefSeq ID-2: NM_001282450.2

Summary: ESRRA encodes a nuclear receptor that interacts with PGC-1 cofactors to regulate mitochondrial biogenesis and energy production. It promotes oxidative metabolism and thermogenesis in adipocytes, influencing fat accumulation and obesity susceptibility. A processed pseudogene is located on chromosome 13q12.1.

LipoKnoxa™ Human ESRRA shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products