LipoKnoxa™ Human FOXO1 shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX581-1	CATGGACAACAACAGTAAATT	CDS	Inquiry
V0126XX581-2	CAGGACAATAAGTCGAGTTAT	CDS	Inquiry
V0126XX581-3	GCCTGTTATCAATCTGCTAAA	3' UTR	Inquiry
V0126XX581-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human FOXO1 shRNA Lentiviral Particle (Silencing) provides a powerful mechanism for the persistent knockdown of FOXO1, a central transcription factor in gluconeogenesis and adipogenesis. Our system utilizes both U6 and miR30-based shRNA architectures to provide researchers with flexibility between maximum silencing depth and physiologically optimized expression. This tool facilitates the study of insulin signaling and glucose output. Every batch is validated through total quality control, including sequence integrity and microbial safety checks, ensuring results are scientifically robust and reproducible.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: FOXO1

Full Name: Forkhead box O1

Gene Symbol: FKH1; FKHR; FOXO1A

Gene ID: 2308

RefSeq ID-1: NP_002006.2

RefSeq ID-2: NM_002015.3

Summary: FOXO1 encodes a forkhead transcription factor involved in gluconeogenesis, adipocyte differentiation, and oxidative stress response. It regulates energy homeostasis and fat storage, making it a key gene in obesity and insulin resistance pathways. Translocations with PAX3 are linked to certain cancers, but its metabolic role is critical in energy balance.

LipoKnoxa™ Human FOXO1 shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products