LipoKnoxa™ Human TNMD shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX626-1	GAGAGAGGTTATTGTTGTATT	CDS	Inquiry
V0126XX626-2	CGCGTCTGTGAACCTTTACTA	CDS	Inquiry
V0126XX626-3	GAGGAAATAGATGAGAATGAA	CDS	Inquiry
V0126XX626-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human TNMD shRNA Lentiviral Particle (Silencing) targets tenomodulin, an adipokine associated with healthy adipose tissue expansion and metabolic flexibility. Engineered with both U6 and miR30-based shRNA frameworks, this tool enables researchers to investigate fat depot remodeling in obesity. To ensure the highest level of biosafety, all preparations undergo total QC verification—covering functional titer, sequence integrity, and mycoplasma testing—ensuring repeatable and high-fidelity results.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: TNMD

Full Name: Tenomodulin

Gene Symbol: TEM; CHM1L; BRICD4

Gene ID: 64102

RefSeq ID-1: NP_071427.2

RefSeq ID-2: NM_022144.3

Summary: TNMD encodes a protein related to chondromodulin-I and functions as an angiogenesis inhibitor. It is involved in regulating endothelial cell tube formation and tissue vascularization. Genetic variation in TNMD has been associated with central obesity, type 2 diabetes risk, and systemic immune mediator levels in a body size–dependent manner, highlighting its role in adipose tissue expansion and metabolic disease.

LipoKnoxa™ Human TNMD shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products