LipoKnoxa™ Human STAT1 shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX616

Species: Human

Target Gene: STAT1

Vector System: Lentiviral

Modulation Type: Silencing (shRNA)

LipoKnoxa™ Human STAT1 shRNA Lentiviral Particle (Silencing)

INQUIRY Datasheet MSDS

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX616-1	CTGGAAGATTTACAAGATGAA	CDS	Inquiry
V0126XX616-2	CCCAAAGTATCAGGACGAGAA	3' UTR	Inquiry
V0126XX616-3	CCCTGAAGTATCTGTATCCAA	CDS	Inquiry
V0126XX616-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human STAT1 shRNA Lentiviral Particle (Silencing) targets STAT1, involved in inflammatory gene expression and adipocyte dysfunction. Utilizing both high-potency U6 and physiologically optimized miR30 architectures, researchers can study the impact of interferon signaling on metabolism. Each viral preparation is backed by exhaustive QC documentation confirming functional titer and sterility, ensuring high-fidelity results in metabolic inflammation research.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: STAT1

Full Name: Signal transducer and activator of transcription 1

Gene Symbol: CANDF7; IMD31A; IMD31B; IMD31C; ISGF-3; STAT91

Gene ID: 6772

RefSeq ID-1: NP_009330.1

RefSeq ID-2: NM_007315.4

Summary: STAT1 encodes a signal transducer and activator of transcription that is activated by cytokines and growth factors, including interferons, EGF, PDGF, and IL6. Upon phosphorylation, STAT1 forms dimers that translocate to the nucleus and regulate gene expression involved in immune defense and cell survival. While STAT1 is essential for antiviral, antifungal, and antimycobacterial immunity, chronic STAT1 activation has been linked to inflammatory signaling pathways that can exacerbate obesity-related insulin resistance. Mutations in STAT1 are associated with Immunodeficiency 31A, 31B, and 31C.

Related Products

Inquiry

Inquiry Basket

Delete selected Check Out