Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human INSR shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX462
Species: Human
Target Gene: INSR
Vector System: Lentiviral
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human INSR shRNA Lentiviral Particle (Silencing)
SPECIFIC INQUIRY
Mammalian Cell Selection:
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX462-1 CTCGTTTGGTTACCAATTTAA 3' UTR Inquiry
V0126XX462-2 GCCAAGAGTGACATCATTTAT CDS Inquiry
V0126XX462-3 GTGCTGTATGAAGTGAGTTAT CDS Inquiry
V0126XX462-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human INSR shRNA Lentiviral Particle (Silencing) facilitates the specific and stable knockdown of the human INSR to model insulin resistance in vitro. Our platform utilizes two distinct expression strategies—U6 for maximum knockdown and miR30-based for natural processing—to study downstream metabolic signaling. Every batch is subjected to rigorous quality control, including functional titer, sterility, and mycoplasma testing, ensuring experimental safety and reproducibility.
Production Cell Line: HEK293T
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.
Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.
Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.
Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.
Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.
Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.
Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.
Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: INSR
Full Name: Insulin receptor
Gene Symbol: HHF5; CD220
Gene ID: 3643
RefSeq ID-1: NP_000199.2
RefSeq ID-2: NM_000208.4
Summary: INSR encodes a receptor tyrosine kinase that forms a heterotetrameric receptor composed of alpha and beta subunits following proteolytic processing. The binding of insulin or other ligands activates the insulin signaling pathway, regulating glucose uptake, carbohydrate, lipid, and protein metabolism. Mutations in INSR result in severe inherited insulin resistance syndromes, including type A insulin resistance, Donohue syndrome, and Rabson-Mendenhall syndrome. Alternative splicing produces multiple transcript variants.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.