LipoKnoxa™ Human APOE shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX470-1	GCTGATGGACGAGACCATGAA	CDS	Inquiry
V0126XX470-2	ACGAGACCATGAAGGAGTTGA	CDS	Inquiry
V0126XX470-3	TGCCCAGCGACAATCACTGAA	CDS	Inquiry
V0126XX470-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human APOE shRNA Lentiviral Particle (Silencing) targets apolipoprotein E, a critical ligand for the clearance of triglyceride-rich lipoproteins. Engineered via our dual-strategy platform (U6 and miR30 systems), this tool allows for the exploration of cholesterol metabolism and atherosclerosis in stable cell models. To guarantee experimental reliability, every preparation undergoes total QC verification—covering functional titer, sequence identity, and mycoplasma testing.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: APOE

Full Name: Apolipoprotein E

Gene Symbol: AD2; LPG; APO-E; ApoE4; LDLCQ5

Gene ID: 348

RefSeq ID-1: NP_000032.1

RefSeq ID-2: NM_000041.4

Summary: APOE encodes a major apolipoprotein of chylomicrons, essential for binding liver and peripheral cell receptors and mediating the clearance of triglyceride-rich lipoproteins. The gene is located on chromosome 19 in a cluster with APOC1 and APOC2. Mutations in APOE lead to familial dysbetalipoproteinemia (type III hyperlipoproteinemia), causing elevated plasma cholesterol and triglycerides due to impaired clearance of chylomicron and VLDL remnants.

LipoKnoxa™ Human APOE shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products