LipoKnoxa™ Human PPARGC1B shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX509-1	GCATAGTCTAGGCAAAGAAAT	CDS	Inquiry
V0126XX509-2	AGCAACTCTATGCTGACTTTC	CDS	Inquiry
V0126XX509-3	CCTGAGTATGACACTGTCTTT	CDS	Inquiry
V0126XX509-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human PPARGC1B shRNA Lentiviral Particle (Silencing) targets PPARGC1B, a coactivator involved in mitochondrial biogenesis and hepatic lipogenesis. Engineered with both U6 and miR30-based shRNA architectures, this tool enables the study of energy expenditure in stable cell models. To ensure the highest level of data reliability, every preparation undergoes total QC verification—covering functional activity and sequence identity.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: PPARGC1B

Full Name: PPARG coactivator 1 beta

Gene Symbol: PERC; ERRL1; PGC1B; PGC-1(beta)

Gene ID: 133522

RefSeq ID-1: NP_001166169.1

RefSeq ID-2: NM_001172698.2

Summary: PPARGC1B encodes a transcriptional coactivator that enhances the activity of nuclear receptors and transcription factors such as estrogen receptor alpha, NRF1, and glucocorticoid receptor. It participates in fat oxidation, glucose metabolism, and energy expenditure regulation. This gene shows reduced expression in prediabetic and type 2 diabetes patients, and certain variants are linked to obesity susceptibility. Three transcript variants encoding different isoforms have been reported.

LipoKnoxa™ Human PPARGC1B shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products