Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human TMEM18 shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX520
Species: Human
Target Gene: TMEM18
Vector System: Lentiviral
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human TMEM18 shRNA Lentiviral Particle (Silencing)
SPECIFIC INQUIRY
Mammalian Cell Selection:
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX520-1 TGCGATGAACTGGAGATTATT CDS Inquiry
V0126XX520-2 GAGCTTCATAACTGGGAATTT 3' UTR Inquiry
V0126XX520-3 GCTGCGATGAACTGGAGATTA CDS Inquiry
V0126XX520-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human TMEM18 shRNA Lentiviral Particle (Silencing) targets a transmembrane protein strongly associated with BMI and neural development. Our platform provides high-potency U6 and physiologically refined miR30-based shRNA to explore weight regulation mechanisms. Each preparation is verified via total QC validation—including functional titer and sequence accuracy checks.
Production Cell Line: HEK293T
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.
Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.
Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.
Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.
Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.
Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.
Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.
Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: TMEM18
Full Name: Transmembrane protein 18
Gene Symbol: lncND
Gene ID: 129787
RefSeq ID-1: NP_001339609.1
RefSeq ID-2: NM_001352680.2
Summary: TMEM18 is a nuclear membrane protein with DNA-binding capabilities that plays a significant role in cell migration. Despite its relatively small size, TMEM18 is one of the most powerful genetic loci identified in GWAS for Body Mass Index (BMI). While the precise molecular mechanism is still being elucidated, it is believed to act within the brain's neurodevelopmental centers to influence the long-term regulation of body weight.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.