Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human ADIPOQ shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX429
Species: Human
Target Gene: ADIPOQ
Vector System: Lentiviral
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human ADIPOQ shRNA Lentiviral Particle (Silencing)
SPECIFIC INQUIRY
Mammalian Cell Selection:
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX429-1 ACGGTTAGGAAGTTGATTATT 3' UTR Inquiry
V0126XX429-2 GTTGGAGGCCTTTAGATATTA 3' UTR Inquiry
V0126XX429-3 ATGCTCATATCAATCCTATAA 3' UTR Inquiry
V0126XX429-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human ADIPOQ shRNA Lentiviral Particle (Silencing) facilitates the specific inhibition of adiponectin, an essential modulator of insulin sensitivity and fatty acid oxidation. To investigate the metabolic impact of adiponectin deficiency, our system provides two expression strategies: high-potency U6 systems and physiologically optimized miR30-based shRNA. Every batch is validated through total quality control screening for functional titer, sequence integrity, and sterility, ensuring reliable data for cardiovascular and metabolic studies.
Production Cell Line: HEK293T
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.
Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.
Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.
Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.
Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.
Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.
Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.
Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: ADIPOQ
Full Name: Adiponectin, C1Q and collagen domain containing
Gene Symbol: ACDC; ADPN; APM1; APM-1; GBP28; ACRP30; ADIPQTL1
Gene ID: 9370
RefSeq ID-1: NP_001171271.1
RefSeq ID-2: NM_001177800.2
Summary: ADIPOQ exclusively codes for adiponectin, a unique adipokine structurally resembling collagen and complement factor C1q. This protein circulates abundantly in plasma and functions as a protective signal from fat tissue. Its action enhances insulin sensitivity and promotes fatty acid oxidation in muscle and liver, actively counteracting insulin resistance. Adiponectin levels are typically inversely proportional to body fat mass and are considered a major metabolic marker. Deficiencies in the ADIPOQ protein are clinically linked to severe metabolic dysfunctions, including type 2 diabetes and cardiovascular risk.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.