Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human BBS9 shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX479
Species: Human
Target Gene: BBS9
Vector System: Lentiviral
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human BBS9 shRNA Lentiviral Particle (Silencing)
SPECIFIC INQUIRY
Mammalian Cell Selection:
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX479-1 CCTCATGCCAAGCACAGATAT 3' UTR Inquiry
V0126XX479-2 GCTATTCTGGAAGCGGCATTT CDS Inquiry
V0126XX479-3 CATCTGCTAATAGTCACAGAA 3' UTR Inquiry
V0126XX479-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human BBS9 shRNA Lentiviral Particle (Silencing) focuses on the inhibition of BBS9, providing a stable model for studying the structural assembly of the BBSome. Engineered with both U6 and miR30-based shRNA frameworks, this tool allows for the exploration of ciliary-dependent energy homeostasis. All particles are screened through exhaustive QC screening—including functional titer and sterility checks—to ensure consistent performance and experimental reproducibility.
Production Cell Line: HEK293T
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.
Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.
Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.
Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.
Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.
Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.
Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.
Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: BBS9
Full Name: Bardet-Biedl syndrome 9
Gene Symbol: B1; D1; C18; PTHB1
Gene ID: 27241
RefSeq ID-1: NP_001028776.1
RefSeq ID-2: NM_001033604.2
Summary: BBS9 encodes a protein that is a subunit of the BBSome complex, essential for ciliary function and trafficking. Its expression is known to be downregulated by parathyroid hormone in osteoblastic cells, suggesting a potential role in PTH signaling pathways within bone. While its precise function is still under investigation, mutations in BBS9 are implicated in Bardet-Biedl syndrome (BBS). As with all BBS genes, the resulting dysfunction in ciliary signaling leads to the characteristic BBS phenotype, which includes multi-organ defects and severe, monogenic obesity.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.