Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human BBS2 shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX465
Species: Human
Target Gene: BBS2
Vector System: Lentiviral
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human BBS2 shRNA Lentiviral Particle (Silencing)
SPECIFIC INQUIRY
Mammalian Cell Selection:
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX465-1 GACTTGCTAAATGGATATAAA CDS Inquiry
V0126XX465-2 ATTACGAAAGGTGCTAGTTAA CDS Inquiry
V0126XX465-3 TAGTAGTACTGTTGCTGAATA 3' UTR Inquiry
V0126XX465-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human BBS2 shRNA Lentiviral Particle (Silencing) focuses on the persistent knockdown of BBS2 to investigate the molecular mechanisms of ciliary dysfunction in obesity. This tool is developed using both high-potency U6 and physiologically refined miR30-based shRNA systems to provide either maximal or regulated knockdown depth. Rigorous quality control, including functional titering and sterility testing, is performed on all particles to guarantee experimental safety and reproducibility.
Production Cell Line: HEK293T
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.
Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.
Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.
Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.
Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.
Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.
Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.
Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: BBS2
Full Name: Bardet-Biedl syndrome 2
Gene Symbol: BBS; RP74
Gene ID: 583
RefSeq ID-1: NP_001364385.1
RefSeq ID-2: NM_001377456.1
Summary: BBS2 is a member of the Bardet-Biedl syndrome (BBS) gene family, which is associated with an autosomal recessive disorder characterized by obesity, retinal dystrophy, polydactyly, renal anomalies, and cognitive impairment. BBS proteins are structurally diverse but share roles in cilia formation and function. Many localize to basal bodies, ciliary axonemes, and pericentriolar regions and participate in microtubule-dependent intracellular trafficking. BBS2 is a component of the BBSome complex with seven other BBS proteins.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.