LipoKnoxa™ Human BBS12 shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX483-1	ACTGTTGTGTCAGTATCTAAT	CDS	Inquiry
V0126XX483-2	CCGAGCATTGGATTTAGTATT	CDS	Inquiry
V0126XX483-3	ATGTGTCCGAACGCTTAATTG	CDS	Inquiry
V0126XX483-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human BBS12 shRNA Lentiviral Particle (Silencing) targets a chaperonin-like protein involved in the early stages of BBSome formation. Our RNAi platform develops this tool using both U6-driven and miR30-based shRNA systems to provide either maximal or regulated silencing. To guarantee experimental reliability, every preparation undergoes total QC verification—covering functional titer, sequence identity, and mycoplasma testing.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: BBS12

Full Name: Bardet-Biedl syndrome 12

Gene Symbol: C4orf24

Gene ID: 166379

RefSeq ID-1: NP_001171478.1

RefSeq ID-2: NM_001178007.2

Summary: BBS12 encodes a chaperonin-like protein that participates in protein folding and intracellular membrane trafficking. It is essential for the assembly of the BBSome complex and contributes to adipocyte differentiation. Defective BBS12 function causes Bardet–Biedl syndrome type 12, a ciliopathy associated with obesity, retinal degeneration, and other clinical features. Two transcript variants encoding the same protein have been described.

LipoKnoxa™ Human BBS12 shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products