LipoKnoxa™ Human TFAM shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX530-1	GGCGGAGTGGCAGGTATATAA	CDS	Inquiry
V0126XX530-2	GTAAGTTCTTACCTTCGATTT	CDS	Inquiry
V0126XX530-3	CGTCGCACAATAAAGAAACAA	CDS	Inquiry
V0126XX530-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human TFAM shRNA Lentiviral Particle (Silencing) targets TFAM, essential for mtDNA maintenance. By utilizing optimized U6 and miR30-based shRNA delivery, this tool assists in uncovering the pathways of mitochondrial biogenesis. Each batch is subjected to rigorous QC verification—covering sequence integrity, functional titer, and the absence of mycoplasma.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: TFAM

Full Name: Transcription factor A, mitochondrial

Gene Symbol: TCF6; MTTF1; MTTFA; TCF6L1; TCF6L2; TCF6L3; MTDPS15

Gene ID: 7019

RefSeq ID-1: NP_001257711.1

RefSeq ID-2: NM_001270782.2

Summary: TFAM is an essential regulator of mitochondrial health, containing motifs that allow it to bind and organize mitochondrial DNA. It is required for the replication, repair, and transcription of the mitochondrial genome. Since mitochondria are the sites of fat and sugar burning, TFAM activity directly determines a cell's metabolic capacity. Genetic variations in TFAM are linked to metabolic decline as well as neurodegenerative conditions like Alzheimer's.

LipoKnoxa™ Human TFAM shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products