LipoKnoxa™ Human INS shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX433

Species: Human

Target Gene: INS

Vector System: Lentiviral

Modulation Type: Silencing (shRNA)

LipoKnoxa™ Human INS shRNA Lentiviral Particle (Silencing)

INQUIRY Datasheet MSDS

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX433-1	AGCGTGGCATTGTGGAACAAT	CDS	Inquiry
V0126XX433-2	CCTGCAGAAGCGTGGCATTGT	CDS	Inquiry
V0126XX433-3	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human INS shRNA Lentiviral Particle (Silencing) provides a robust system for the stable knockdown of the insulin gene to study the cellular impact of hypoinsulinemia. This tool is developed using both high-potency U6 and physiologically refined miR30-based shRNA systems to accommodate different experimental requirements. Every batch is verified via comprehensive QC—including functional titer, sequence identity, and sterility—to ensure that your glucose metabolism research is both safe and scientifically sound.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: INS

Full Name: Insulin

Gene Symbol: IDDM; ILPR; IRDN; IDDM1; IDDM2; PNDM4; MODY10

Gene ID: 3630

RefSeq ID-1: NP_000198.1

RefSeq ID-2: NM_000207.3

Summary: INS is the gene responsible for synthesizing Proinsulin, the precursor to the pivotal peptide hormone, Insulin. Following cleavage of the signal peptide, Proinsulin is processed into the mature, active hormone, consisting of A and B chains linked by disulfide bonds, plus the C-peptide. Insulin's binding to the INSR is the primary signal for stimulating glucose uptake and regulating systemic carbohydrate and lipid metabolism. Defects in INS can cause various forms of diabetes, ranging from permanent neonatal diabetes to hyperproinsulinemia and MODY Type 10, highlighting its absolute necessity for metabolic health.

Related Products

Inquiry

Inquiry Basket

Delete selected Check Out