LipoKnoxa™ Human OPA1 shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX577-1	CGGACCTTAGTGAATATAAAT	CDS	Inquiry
V0126XX577-2	CCGGACCTTAGTGAATATAAA	CDS	Inquiry
V0126XX577-3	CTCACCATGTGGCCCTATTTA	CDS	Inquiry
V0126XX577-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human OPA1 shRNA Lentiviral Particle (Silencing) targets OPA1, an essential protein for mitochondrial cristae organization and fusion. Silencing OPA1 through our optimized U6 or miR30-based shRNA delivery systems allows for the investigation of how mitochondrial fragmentation contributes to insulin resistance and fat storage. Each preparation undergoes comprehensive quality control, including functional titer and mycoplasma testing, ensuring excellent biosafety for reliable in vitro applications. This powerful RNAi tool supports flexible reporter gene inclusion to track knockdown efficiency in real-time.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: OPA1

Full Name: OPA1 mitochondrial dynamin like GTPase

Gene Symbol: NPG; NTG; MGM1; BERHS; largeG; MTDPS14

Gene ID: 4976

RefSeq ID-1: NP_056375.2

RefSeq ID-2: NM_015560.3

Summary: OPA1 encodes a mitochondrial dynamin-related GTPase that maintains inner mitochondrial membrane stability and energy production. Proper OPA1 function ensures efficient lipid oxidation and energy balance, with dysregulation potentially contributing to metabolic disorders and obesity.

LipoKnoxa™ Human OPA1 shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products