Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human KCNJ11 shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX490
Species: Human
Target Gene: KCNJ11
Vector System: Lentiviral
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human KCNJ11 shRNA Lentiviral Particle (Silencing)
SPECIFIC INQUIRY
Mammalian Cell Selection:
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX490-1 AGTTTGGCAACACCGTCAAAG CDS Inquiry
V0126XX490-2 TGATCATCTACCATGTCATTG CDS Inquiry
V0126XX490-3 GCCCGCTTTGTGTCCAAGAAA CDS Inquiry
V0126XX490-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human KCNJ11 shRNA Lentiviral Particle (Silencing) targets KCNJ11. This silencing tool is built on an advanced RNAi platform supporting both U6 and miR30-based shRNA systems to study glucose-stimulated insulin release. Each preparation is verified via thorough QC validation, including functional titer and sterility testing, ensuring results are scientifically sound and safe for endocrine research.
Production Cell Line: HEK293T
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.
Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.
Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.
Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.
Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.
Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.
Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.
Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: KCNJ11
Full Name: Potassium inwardly rectifying channel subfamily J member 11
Gene Symbol: BIR; HHF2; PHHI; IKATP; PNDM2; TNDM3; KIR6.2; MODY13
Gene ID: 3767
RefSeq ID-1: NP_000516.3
RefSeq ID-2: NM_000525.3
Summary: KCNJ11 encodes an inward-rectifying potassium channel that forms part of the ATP-sensitive K⁺ channel complex in pancreatic β-cells. This channel controls insulin secretion in response to cellular metabolic changes and interacts with the sulfonylurea receptor SUR. Mutations in KCNJ11 cause hyperinsulinemic hypoglycemia of infancy, neonatal diabetes, and contribute to type 2 diabetes risk. Dysfunctional KCNJ11-mediated insulin regulation can indirectly influence body weight and predispose to obesity. Multiple alternatively spliced isoforms have been described.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.