LipoKnoxa™ Human KCNJ11 shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX490-1	AGTTTGGCAACACCGTCAAAG	CDS	Inquiry
V0126XX490-2	TGATCATCTACCATGTCATTG	CDS	Inquiry
V0126XX490-3	GCCCGCTTTGTGTCCAAGAAA	CDS	Inquiry
V0126XX490-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human KCNJ11 shRNA Lentiviral Particle (Silencing) targets KCNJ11. This silencing tool is built on an advanced RNAi platform supporting both U6 and miR30-based shRNA systems to study glucose-stimulated insulin release. Each preparation is verified via thorough QC validation, including functional titer and sterility testing, ensuring results are scientifically sound and safe for endocrine research.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: KCNJ11

Full Name: Potassium inwardly rectifying channel subfamily J member 11

Gene Symbol: BIR; HHF2; PHHI; IKATP; PNDM2; TNDM3; KIR6.2; MODY13

Gene ID: 3767

RefSeq ID-1: NP_000516.3

RefSeq ID-2: NM_000525.3

Summary: KCNJ11 encodes an inward-rectifying potassium channel that forms part of the ATP-sensitive K⁺ channel complex in pancreatic β-cells. This channel controls insulin secretion in response to cellular metabolic changes and interacts with the sulfonylurea receptor SUR. Mutations in KCNJ11 cause hyperinsulinemic hypoglycemia of infancy, neonatal diabetes, and contribute to type 2 diabetes risk. Dysfunctional KCNJ11-mediated insulin regulation can indirectly influence body weight and predispose to obesity. Multiple alternatively spliced isoforms have been described.

LipoKnoxa™ Human KCNJ11 shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products