LipoKnoxa™ Human CCK shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX502-1	ACCCAGAGGAGGCAGAATAAG	3' UTR	Inquiry
V0126XX502-2	CTACATGGGCTGGATGGATTT	CDS	Inquiry
V0126XX502-3	CTGTGGAGTTTGACATTGTAT	3' UTR	Inquiry
V0126XX502-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human CCK shRNA Lentiviral Particle (Silencing) targets cholecystokinin, a gut-brain peptide that promotes satiety. Utilizing an optimized shRNA framework (supporting U6 and miR30 systems), this tool allows for the investigation of meal termination signals in stable endocrine cell lines. Each preparation is verified via thorough QC validation, including sequence integrity and microbial safety checks.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: CCK

Full Name: Cholecystokinin

Gene ID: 885

RefSeq ID-1: NP_000720.1

RefSeq ID-2: NM_000729.6

Summary: CCK encodes a member of the gastrin/cholecystokinin family of peptides. The precursor protein is processed into multiple active forms, including cholecystokinin-8, -12, and -33, which regulate gastric acid secretion and appetite. A sulfated form of cholecystokinin-8 may also modulate neuronal activity. Alternative splicing generates several transcript variants.

LipoKnoxa™ Human CCK shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products