LipoKnoxa™ Human ABCC8 shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX495-1	TCGGAGTCAGTGCCTTAATTG	CDS	Inquiry
V0126XX495-2	AGCAATACAGACCAAGATTTA	CDS	Inquiry
V0126XX495-3	GTGCCATCCTTGAGTTCGATA	CDS	Inquiry
V0126XX495-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human ABCC8 shRNA Lentiviral Particle (Silencing) targets ABCC8, playing a pivotal role in insulin secretion. Engineered with both U6 and miR30-based shRNA architectures, this tool enables the stable dissection of beta-cell function in metabolic disease models. We ensure the highest level of biosafety through total quality control screening, covering functional titer, sequence verification, and sterility checks.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: ABCC8

Full Name: ATP binding cassette subfamily C member 8

Gene Symbol: HI; SUR; HHF1; MRP8; PHHI; SUR1; ABC36; HRINS; PNDM3; TNDM2; MODY12; SUR1delta2

Gene ID: 6833

RefSeq ID-1: NP_000343.2

RefSeq ID-2: NM_000352.6

Summary: ABCC8 encodes a subunit of ATP-sensitive potassium channels that regulates insulin secretion from pancreatic β-cells. Mutations can cause hyperinsulinemic hypoglycemia of infancy or contribute to type 2 diabetes. Altered ABCC8 function affects insulin release and glucose homeostasis, linking it to obesity risk.

LipoKnoxa™ Human ABCC8 shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products