Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human GHSR shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX535
Species: Human
Target Gene: GHSR
Vector System: Lentiviral
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human GHSR shRNA Lentiviral Particle (Silencing)
SPECIFIC INQUIRY
Mammalian Cell Selection:
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX535-1 CACGGTCCTCTACAGTCTCAT CDS Inquiry
V0126XX535-2 TCCTCTGCAAACTCTTCCAAT CDS Inquiry
V0126XX535-3 TTCTCCGATCTGCTCATCTTC CDS Inquiry
V0126XX535-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human GHSR shRNA Lentiviral Particle (Silencing) targets the ghrelin receptor to study appetite regulation in stable cell lines. By utilizing high-potency U6-driven shRNA or physiologically refined miR30 architectures, researchers can investigate ghrelin-mediated hunger signaling. Every preparation is verified via thorough QC validation, including sequence integrity and microbial safety checks.
Production Cell Line: HEK293T
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.
Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.
Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.
Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.
Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.
Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.
Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.
Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: GHSR
Full Name: Growth hormone secretagogue receptor
Gene Symbol: GHDP; GHS-R1a; GHSR-1a
Gene ID: 2693
RefSeq ID-1: NP_004113.1
RefSeq ID-2: NM_004122.2
Summary: GHSR encodes a ghrelin-responsive G protein–coupled receptor that participates in neuroendocrine regulation of appetite and growth hormone secretion. The functional receptor isoform mediates ghrelin signaling that promotes food intake and energy storage, while alternative isoforms may modulate receptor activity. GHSR signaling is therefore central to body weight regulation.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.