LipoKnoxa™ Human GHSR shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX535-1	CACGGTCCTCTACAGTCTCAT	CDS	Inquiry
V0126XX535-2	TCCTCTGCAAACTCTTCCAAT	CDS	Inquiry
V0126XX535-3	TTCTCCGATCTGCTCATCTTC	CDS	Inquiry
V0126XX535-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human GHSR shRNA Lentiviral Particle (Silencing) targets the ghrelin receptor to study appetite regulation in stable cell lines. By utilizing high-potency U6-driven shRNA or physiologically refined miR30 architectures, researchers can investigate ghrelin-mediated hunger signaling. Every preparation is verified via thorough QC validation, including sequence integrity and microbial safety checks.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: GHSR

Full Name: Growth hormone secretagogue receptor

Gene Symbol: GHDP; GHS-R1a; GHSR-1a

Gene ID: 2693

RefSeq ID-1: NP_004113.1

RefSeq ID-2: NM_004122.2

Summary: GHSR encodes a ghrelin-responsive G protein–coupled receptor that participates in neuroendocrine regulation of appetite and growth hormone secretion. The functional receptor isoform mediates ghrelin signaling that promotes food intake and energy storage, while alternative isoforms may modulate receptor activity. GHSR signaling is therefore central to body weight regulation.

LipoKnoxa™ Human GHSR shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products