LipoKnoxa™ Human CLMP shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX599-1	GAATGGCTGCTCACCGATAAT	CDS	Inquiry
V0126XX599-2	CCAGTCGTCATGTCTACAATA	CDS	Inquiry
V0126XX599-3	GAAGAAGAGAGACCTAATGAA	CDS	Inquiry
V0126XX599-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human CLMP shRNA Lentiviral Particle (Silencing) targets the CXADR-like membrane protein, an identified modifier of fat mass expansion. Utilizing an advanced RNAi platform with optimized U6 or miR30-based shRNA delivery, this tool enables researchers to investigate adipocyte differentiation and cell-cell interaction in fat depots. Every preparation undergoes total quality control verification—covering functional activity, sequence identity, and sterility—providing a secure foundation for obesity research.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: CLMP

Full Name: CXADR like cell adhesion molecule

Gene Symbol: ACAM; ASAM; CSBM; CSBS

Gene ID: 79827

RefSeq ID-1: NP_079045.1

RefSeq ID-2: NM_024769.5

Summary: CLMP is a transmembrane protein located at the junctions between cells, providing structural adhesion. While essential for the normal development of the intestines, its expression in white adipose tissue is increasingly linked to adipocyte maturation. Dysregulation of CLMP-mediated adhesion can disrupt the healthy expansion of fat tissue, contributing to the development of obesity.

LipoKnoxa™ Human CLMP shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products