LipoKnoxa™ Human PDK4 shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX590-1	CCCGTGTCAATTAACATTTAA	3' UTR	Inquiry
V0126XX590-2	GTTCGAAATAGACACCATAAT	CDS	Inquiry
V0126XX590-3	GTGCAAGACTACAGGAGTTAA	3' UTR	Inquiry
V0126XX590-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human PDK4 shRNA Lentiviral Particle (Silencing) focuses on the inhibition of PDK4, an enzyme that inhibits glucose oxidation and promotes fatty acid use. By utilizing high-potency U6-driven shRNA or physiologically optimized miR30 architectures, researchers can study metabolic switching in muscle and liver cells, etc. This silencing tool is backed by comprehensive QC documentation, confirming functional titer, sterility, and sequence integrity, providing a secure and high-performing technical platform for metabolic studies.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: PDK4

Full Name: Pyruvate dehydrogenase kinase 4

Gene ID: 5166

RefSeq ID-1: NP_002603.1

RefSeq ID-2: NM_002612.4

Summary: PDK4 encodes a mitochondrial kinase that inhibits the pyruvate dehydrogenase complex, regulating glucose oxidation and metabolic flexibility. By controlling fuel utilization in adipocytes and other tissues, PDK4 contributes to energy balance and obesity risk. Expression is regulated by insulin, glucocorticoids, and retinoic acid.

LipoKnoxa™ Human PDK4 shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products