LipoKnoxa™ Human CEP19 shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX448

Species: Human

Target Gene: CEP19

Vector System: Lentiviral

Modulation Type: Silencing (shRNA)

LipoKnoxa™ Human CEP19 shRNA Lentiviral Particle (Silencing)

INQUIRY Datasheet MSDS

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX448-1	GTTTCAGCCTCCAGCTATTAT	CDS	Inquiry
V0126XX448-2	CCAGAGCTGCTGAACAATTAA	CDS	Inquiry
V0126XX448-3	TGGGAAATCCACCCATAATAA	3' UTR	Inquiry
V0126XX448-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human CEP19 shRNA Lentiviral Particle (Silencing) targets CEP19, a gene linked to morbid obesity and impaired energy balance. Utilizing an advanced RNAi platform with optimized U6 or miR30-based shRNA delivery, this tool helps researchers understand the centrosomal regulation of metabolism. Every preparation undergoes total QC verification, including sequence accuracy and microbial safety checks, providing a secure technical foundation for metabolic research.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: CEP19

Full Name: Centrosomal protein 19

Gene Symbol: MOSPGF; C3orf34

Gene ID: 84984

RefSeq ID-1: NP_001366398.1

RefSeq ID-2: NM_001379469.1

Summary: CEP19 encodes a protein that localizes to centrosomes and primary cilia, specifically associating with the mother centriole. While its molecular function is focused on cilia and centrosome integrity, this gene is located in a chromosomal region linked to severe obesity. Functional studies, particularly in mouse models where the orthologous gene is knocked out, demonstrate a profound metabolic phenotype, including morbid obesity, hyperphagy (excessive eating), glucose intolerance, and insulin resistance. In humans, mutations in CEP19 directly cause Morbid Obesity and Spermatogenic Failure (MOSPGF), underscoring the critical link between ciliary function and energy balance.

Related Products

Inquiry

Inquiry Basket

Delete selected Check Out