Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human MC3R shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX437
Species: Human
Target Gene: MC3R
Vector System: Lentiviral
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human MC3R shRNA Lentiviral Particle (Silencing)
SPECIFIC INQUIRY
Mammalian Cell Selection:
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX437-1 GACCTTCGAGGACCAGTTTAT CDS Inquiry
V0126XX437-2 GTTCAGCCAACACTGCCTAAT CDS Inquiry
V0126XX437-3 CCAGCACATGGACAACATCTT CDS Inquiry
V0126XX437-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human MC3R shRNA Lentiviral Particle (Silencing) targets the MC3R, involved in nutrient partitioning and energy homeostasis. By utilizing high-potency U6-driven shRNA or physiologically optimized miR30 architectures, researchers can study the distinct metabolic roles of MC3R in long-term cell culture models. Each viral preparation is subjected to total QC verification—covering functional titer, sterility, and mycoplasma—to ensure the highest standards of biosafety.
Production Cell Line: HEK293T
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.
Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.
Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.
Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.
Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.
Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.
Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.
Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: MC3R
Full Name: Melanocortin 3 receptor
Gene Symbol: MC3; OB20; OQTL; BMIQ9; MC3-R
Gene ID: 4159
RefSeq ID-1: NP_063941.3
RefSeq ID-2: NM_019888.3
Summary: MC3R encodes a G-protein-coupled receptor (GPCR) that recognizes both melanocyte-stimulating hormone (MSH) and adrenocorticotropic hormone (ACTH). While part of the melanocortin system, MC3R is expressed in tissues beyond the adrenal cortex and melanocytes, indicating a wider systemic role. Evidence from knockout models (increased fat mass despite reduced food intake) strongly suggests that MC3R is a significant regulator of energy homeostasis. Mutations in MC3R are consistently associated with increased susceptibility to obesity in humans.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.