LipoKnoxa™ Human PLIN2 shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX595-1	TGGTTCAGAAGCCAAGTTATT	CDS	Inquiry
V0126XX595-2	CAGAAGCTAGAGCCGCAAATT	CDS	Inquiry
V0126XX595-3	CAGCCATCAACTCAGATTGTT	CDS	Inquiry
V0126XX595-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human PLIN2 shRNA Lentiviral Particle (Silencing) targets perilipin 2, the primary protein coating lipid droplets in non-adipocytes. Our lentiviral particles are engineered using both high-potency U6-driven and physiologically refined miR30-based shRNA to study ectopic fat accumulation and lipotoxicity. Every batch is subjected to total quality control, including functional titer and mycoplasma detection, ensuring experimental reproducibility and data accuracy for studying lipid droplet dynamics in metabolic disease.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: PLIN2

Full Name: Perilipin 2

Gene Symbol: ADFP; ADRP

Gene ID: 123

RefSeq ID-1: NP_001113.2

RefSeq ID-2: NM_001122.3

Summary: The PLIN2 protein serves as a protective coating for intracellular lipid droplets. While once thought to be exclusive to fat cells, it is now recognized as a universal marker for lipid accumulation across many tissues, including the liver and mammary glands. It is essential for the orderly storage and mobilization of fats, preventing lipid-induced toxicity in non-adipose tissues.

LipoKnoxa™ Human PLIN2 shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products