Products
- Anti-Obesity Compound Library
- GPCR/G Protein-Targeted Compounds
- Immunology/Inflammation-Targeted Compounds
- JAK/STAT-Targeted Compounds
- MAPK-Targeted Compounds
- Membrane Transporter/Ion Channel-Targeted Compounds
- Metabolism-Targeted Compounds
- NF-κB-Targeted Compounds
- Microbiology/Virology-Targeted Compounds
- Neuronal Signaling-Targeted Compounds
- PI3K/Akt/mTOR-Targeted Compounds
- Oxidation-reduction-Targeted Compounds
- Proteases/Proteasome-Targeted Compounds
- Stem Cells/Wnt-Targeted Compounds
- Tyrosine Kinase/Adaptors-Targeted Compounds
- Ubiquitin-Targeted Compounds
Online Inquiry
LipoKnoxa™ Human ATF6 shRNA Lentiviral Particle (Silencing)
Cat. No.:
V0126XX611
Species:
Human
Target Gene:
ATF6
Vector System:
Lentiviral
Modulation Type:
Silencing (shRNA)
SPECIFIC INQUIRY
Add to basket
| Sub Cat. No. | TargetSeq | Region | Inquiry |
|---|---|---|---|
| V0126XX611-1 | ACAGAGTCTCTCAGGTTAAAT | CDS | Inquiry |
| V0126XX611-2 | GATGATAGTATTGGCATTTAT | CDS | Inquiry |
| V0126XX611-3 | CAATTGTGTTACCAGCAATAA | CDS | Inquiry |
| V0126XX611-4 | Other | Inquiry |
Product Overview
Description:
LipoKnoxa™ Human ATF6 shRNA Lentiviral Particle (Silencing) targets ATF6, a primary sensor of ER stress regulating protein folding and lipogenesis. By utilizing either high-potency U6-driven shRNA or physiologically refined miR30-based shRNA, researchers can investigate the cellular response to metabolic overload. Every viral preparation is backed by exhaustive QC validation, including high-precision titering and sterility testing, to ensure that results are scientifically sound and repeatable.
Production Cell Line:
HEK293T
Promoter:
U6; CMV; EF1α; CAG; UBC
Product Availability:
Produced Upon Order
Specification
Titer Test:
qPCR
Insert Verification:
Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.
Sterility Test:
Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.
Mycoplasma Test:
Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.
Other QC:
Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.
Storage:
Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.
Stability:
Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.
Shipping Condition:
Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.
Handling Notes:
Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.
Intended Use:
This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer:
We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.
Target Profile
Gene Name:
ATF6
Full Name:
Activating transcription factor 6
Gene Symbol:
ACHM7; ATF6A; ATP6alpha
Gene ID:
22926
RefSeq ID-1:
NP_031374.2
RefSeq ID-2:
NM_007348.4
Summary:
ATF6 encodes a key transcription factor involved in the unfolded protein response (UPR) activated during endoplasmic reticulum (ER) stress. Uniquely, ATF6 is synthesized as an ER-resident transmembrane protein that functions as a stress sensor; upon ER stress–induced proteolytic cleavage, its cytosolic domain translocates to the nucleus, where it binds ER stress response elements (ERSEs) in the promoters of ER chaperone genes. Beyond its role in cellular stress adaptation, ATF6 has been implicated in metabolic homeostasis, as chronic ER stress in adipose tissue and liver contributes to obesity-associated insulin resistance. Genetic variation in ATF6 has shown population-dependent associations with diabetes and plasma lipid levels, linking ER stress signaling to obesity-related metabolic disorders. ATF6 has also been identified as a survival factor in quiescent squamous carcinoma cells and proposed as a therapeutic target in cystic fibrosis.
Related Products
-
AdipoUpX™ Human FBP1 Lentiviral Particle (Overexpression)
-
AdipoUpX™ Human IL13 Lentiviral Particle (Overexpression)
-
LipoKnoxa™ Human CD36 shRNA Lentiviral Particle (Silencing)
-
AdipoUpX™ Human KSR2 Lentiviral Particle (Overexpression)
-
LipoKnoxa™ Human ACOX1 shRNA Lentiviral Particle (Silencing)
-
AdipoUpX™ Human PLIN2 Lentiviral Particle (Overexpression)