LipoKnoxa™ Human LEP shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX421

Species: Human

Target Gene: LEP

Vector System: Lentiviral

Modulation Type: Silencing (shRNA)

LipoKnoxa™ Human LEP shRNA Lentiviral Particle (Silencing)

INQUIRY Datasheet MSDS

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX421-1	TATCCAGGACTCTGTCAATTT	3' UTR	Inquiry
V0126XX421-2	ATATATACACAGGATCCTATT	3' UTR	Inquiry
V0126XX421-3	TGTGGCTTTGGCCCTATCTTT	CDS	Inquiry
V0126XX421-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human LEP Lentiviral Particle (shRNA) is engineered for robust and stable silencing of the human LEP (Leptin) gene, facilitating long-term gene knockdown in both dividing and non-dividing cells. This powerful RNAi tool allows for the in-depth exploration of LEP-mediated signaling pathways and their impact on metabolic homeostasis and adipose tissue function. Our customizable lentiviral system supports flexible reporter gene inclusion and diverse promoter options (such as U6 or miR30-based systems), with rigorous quality control ensuring high functional titers and excellent biosafety for reliable in vitro and ex vivo applications.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: LEP

Full Name: Leptin

Gene Symbol: OBS; OB; LEPD

Gene ID: 3952

RefSeq ID-1: NP_000221.1

RefSeq ID-2: NM_000230.3

Summary: LEP (leptin) protein is a key signaling molecule secreted by adipocytes, primarily functioning as a thermostat for body weight to regulate systemic energy balance. By binding to specific receptors in the brain, circulating leptin activates signaling pathways that effectively suppress appetite and accelerate metabolism. Beyond its classic metabolic role, LEP exerts broad endocrine regulatory effects, influencing immune function, inflammation, angiogenesis, and reproductive processes. Clinical mutations in LEP and its regulatory regions are directly associated with the onset and progression of severe obesity, hypogonadism, and type 2 diabetes.

Related Products

Inquiry

Inquiry Basket

Delete selected Check Out