LipoKnoxa™ Human PHB1 shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX618-1	ATCACTTCAGATCTCTAATTA	3' UTR	Inquiry
V0126XX618-2	CCCAGAAATCACTGTGAAATT	3' UTR	Inquiry
V0126XX618-3	CGTGGTGAACTCTGCCTTATA	CDS	Inquiry
V0126XX618-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human PHB1 shRNA Lentiviral Particle (Silencing) targets prohibitin 1, which regulates mitochondrial function and adipocyte signaling pathways. Engineered with both U6 and miR30-based shRNA frameworks, this tool allows for the exploration of mitochondrial integrity in metabolic disease. All batches are subjected to rigorous quality control, including high-precision functional titering and sterility testing, ensuring scientific robustness and excellent biosafety for in vitro cellular models.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: PHB1

Full Name: Prohibitin 1

Gene Symbol: PHB; BAP32; HEL-215; HEL-S-54e

Gene ID: 5245

RefSeq ID-1: NP_001268425.1

RefSeq ID-2: NM_001281496.2

Summary: PHB1 is an evolutionarily conserved gene implicated in cellular senescence, mitochondrial function, and tumor suppression. Its antiproliferative activity has been attributed to regulatory elements within the 3′ untranslated region, which may function as trans-acting RNA. PHB1 also plays roles in mitochondrial integrity and energy metabolism, linking it to obesity through regulation of adipocyte function and systemic metabolic homeostasis. Several pseudogenes and alternatively spliced transcript variants have been identified.

LipoKnoxa™ Human PHB1 shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products