LipoKnoxa™ Human ACSL1 shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX613

Species: Human

Target Gene: ACSL1

Vector System: Lentiviral

Modulation Type: Silencing (shRNA)

LipoKnoxa™ Human ACSL1 shRNA Lentiviral Particle (Silencing)

INQUIRY Datasheet MSDS

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX613-1	AGACCTGAGTGGGTGATTATT	CDS	Inquiry
V0126XX613-2	CACATTGCACCCTGAATTATT	CDS	Inquiry
V0126XX613-3	TTGAGACTTCCTCAGTTTAAA	3' UTR	Inquiry
V0126XX613-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human ACSL1 shRNA Lentiviral Particle (Silencing) targets ACSL1, critical for fatty acid oxidation and triglyceride synthesis. By offering both high-potency U6-driven shRNA and physiologically refined miR30-based architectures, this tool helps researchers investigate lipid partitioning in heart and muscle tissues. Each preparation is verified via total QC validation—including functional titer, sequence integrity, and the total absence of pathogens.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: ACSL1

Full Name: Acyl-CoA synthetase long chain family member 1

Gene Symbol: ACS1; LACS; FACL1; FACL2; LACS1; LACS2

Gene ID: 2180

RefSeq ID-1: NP_001273637.1

RefSeq ID-2: NM_001286708.2

Summary: ACSL1 encodes a long-chain acyl-CoA synthetase isozyme that catalyzes the conversion of free long-chain fatty acids into fatty acyl-CoA esters. Although members of this enzyme family differ in substrate preference, tissue distribution, and subcellular localization, all play essential roles in lipid biosynthesis and fatty acid degradation. ACSL1 is highly relevant to obesity, as it regulates the balance between lipid storage and oxidation in metabolically active tissues such as adipose tissue, liver, and muscle. Dysregulation of ACSL1 activity can promote ectopic lipid accumulation and insulin resistance. Multiple alternatively spliced transcript variants have been described.

Related Products

Inquiry

Inquiry Basket

Delete selected Check Out