LipoKnoxa™ Human CIDEA shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX553-1	GAGAGTCACCTTCGACTTGTA	CDS	Inquiry
V0126XX553-2	GCCAAACACTGTGTTTCGTTT	3' UTR	Inquiry
V0126XX553-3	GACGGGACAGTTTCTCATCTA	CDS	Inquiry
V0126XX553-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human CIDEA shRNA Lentiviral Particle (Silencing) targets a lipid droplet protein that regulates fat storage and thermogenesis. Developed via our dual-strategy platform (U6 and miR30 systems), this tool helps researchers study adipose tissue phenotypes. Every batch is verified through a comprehensive QC suite—including functional titer, sequence integrity, and sterility testing.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: CIDEA

Full Name: Cell death inducing DFFA like effector a

Gene Symbol: CIDE-A

Gene ID: 1149

RefSeq ID-1: NP_001270.1

RefSeq ID-2: NM_001279.4

Summary: CIDEA acts as a major regulator of energy expenditure and fat accumulation. In animal models, the absence of CIDEA leads to an increased metabolic rate and enhanced thermogenesis in brown adipose tissue, conferring resistance to diet-induced obesity. While it shares structural homology with cell death-inducing factors, its primary physiological impact lies in modulating lipolysis and core body temperature during cold exposure.

LipoKnoxa™ Human CIDEA shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products