Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human KCNJ5 shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX579
Species: Human
Target Gene: KCNJ5
Vector System: Lentiviral
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human KCNJ5 shRNA Lentiviral Particle (Silencing)
SPECIFIC INQUIRY
Mammalian Cell Selection:
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX579-1 GCTCGTCTTCACCATGGTTTA CDS Inquiry
V0126XX579-2 AGATCCATCCATATCACATAG 3' UTR Inquiry
V0126XX579-3 CCATCACCTTGTCCCTCATTC 3' UTR Inquiry
V0126XX579-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human KCNJ5 shRNA Lentiviral Particle (Silencing) is designed to suppress a potassium channel involved in aldosterone secretion and blood pressure regulation, often dysregulated in metabolic syndrome. By utilizing either high-potency U6-driven shRNA or physiologically refined miR30 architectures, researchers can study the intersection of electrolyte balance and metabolic homeostasis. Our customizable lentiviral system supports various promoter options and is backed by exhaustive QC documentation, including functional titer and sterility checks, to ensure high reproducibility in cellular models.
Production Cell Line: HEK293T
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.
Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.
Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.
Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.
Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.
Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.
Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.
Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: KCNJ5
Full Name: Potassium inwardly rectifying channel subfamily J member 5
Gene Symbol: CIR; GIRK4; KATP1; LQT13; KIR3.4
Gene ID: 3762
RefSeq ID-1: NP_000881.3
RefSeq ID-2: NM_000890.3
Summary: KCNJ5 encodes an inward-rectifier potassium channel subunit, controlling cellular membrane potential in endocrine tissues. Its activity can indirectly influence hormonal regulation of metabolism and fat accumulation, linking KCNJ5 to obesity-related endocrine dysfunction.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.