Products
- Anti-Obesity Compound Library
- GPCR/G Protein-Targeted Compounds
- Immunology/Inflammation-Targeted Compounds
- JAK/STAT-Targeted Compounds
- MAPK-Targeted Compounds
- Membrane Transporter/Ion Channel-Targeted Compounds
- Metabolism-Targeted Compounds
- NF-κB-Targeted Compounds
- Microbiology/Virology-Targeted Compounds
- Neuronal Signaling-Targeted Compounds
- PI3K/Akt/mTOR-Targeted Compounds
- Oxidation-reduction-Targeted Compounds
- Proteases/Proteasome-Targeted Compounds
- Stem Cells/Wnt-Targeted Compounds
- Tyrosine Kinase/Adaptors-Targeted Compounds
- Ubiquitin-Targeted Compounds
Online Inquiry
LipoKnoxa™ Human NPY shRNA Lentiviral Particle (Silencing)
Cat. No.:
V0126XX476
Species:
Human
Target Gene:
NPY
Vector System:
Lentiviral
Modulation Type:
Silencing (shRNA)
SPECIFIC INQUIRY
Add to basket
| Sub Cat. No. | TargetSeq | Region | Inquiry |
|---|---|---|---|
| V0126XX476-1 | CCAGCCCAGAGACACTGATTT | CDS | Inquiry |
| V0126XX476-2 | CACCAGGCAGAGATATGGAAA | CDS | Inquiry |
| V0126XX476-3 | GTTCCCAGAACTCGGCTTGAA | CDS | Inquiry |
| V0126XX476-4 | Other | Inquiry |
Product Overview
Description:
LipoKnoxa™ Human NPY shRNA Lentiviral Particle (Silencing) is specifically designed for the stable suppression of neuropeptide Y, one of the most potent stimulators of appetite. Our system provides two distinct expression strategies—U6 and miR30-based shRNA—to investigate the central regulation of energy balance. Each batch is subjected to rigorous quality control, including functional titer, sterility, and mycoplasma testing, providing a secure and high-performing gene-silencing solution.
Production Cell Line:
HEK293T
Promoter:
U6; CMV; EF1α; CAG; UBC
Product Availability:
Produced Upon Order
Specification
Titer Test:
qPCR
Insert Verification:
Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.
Sterility Test:
Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.
Mycoplasma Test:
Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.
Other QC:
Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.
Storage:
Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.
Stability:
Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.
Shipping Condition:
Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.
Handling Notes:
Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.
Intended Use:
This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer:
We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.
Target Profile
Gene Name:
NPY
Full Name:
Neuropeptide Y
Gene Symbol:
PYY4
Gene ID:
4852
RefSeq ID-1:
NP_000896.1
RefSeq ID-2:
NM_000905.4
Summary:
NPY encodes the Neuropeptide Y, a highly abundant neuropeptide widely distributed throughout the central nervous system. NPY acts through G protein-coupled receptors, influencing a wide array of physiological processes, including cortical excitability, stress response, cardiovascular function, and, most notably, food intake (acting as a potent orexigenic, or appetite-stimulating, signal). Molecularly, NPY binding inhibits adenylyl cyclase, activates MAPK, and regulates intracellular ion channels. A polymorphism in the NPY signal peptide is associated with elevated cholesterol levels, increased alcohol consumption, and may be a risk factor for various metabolic diseases and obesity.