Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human ELOVL6 shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX624
Species: Human
Target Gene: ELOVL6
Vector System: Lentiviral
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human ELOVL6 shRNA Lentiviral Particle (Silencing)
SPECIFIC INQUIRY
Mammalian Cell Selection:
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX624-1 GCTCTGTATGCTGCCTTTATA CDS Inquiry
V0126XX624-2 CCCTTGCAGTCTTCAGTATAT CDS Inquiry
V0126XX624-3 GTCAGCAAATTCTGGGCTTAT CDS Inquiry
V0126XX624-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human ELOVL6 shRNA Lentiviral Particle (Silencing) focuses on the persistent knockdown of the fatty acid elongase responsible for palmitate conversion, a key step in lipotoxicity and insulin resistance. By utilizing optimized U6 and miR30-based shRNA delivery, this tool assists in uncovering the mechanisms of hepatic steatosis. Each viral batch is backed by exhaustive QC documentation, confirming functional titer, sterility, and mycoplasma testing, ensuring optimal data reliability.
Production Cell Line: HEK293T
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.
Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.
Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.
Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.
Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.
Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.
Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.
Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: ELOVL6
Full Name: ELOVL fatty acid elongase 6
Gene Symbol: FAE; LCE; FACE; hELO2
Gene ID: 79071
RefSeq ID-1: NP_001124193.1
RefSeq ID-2: NM_001130721.2
Summary: ELOVL6 encodes a fatty acid elongase that catalyzes the rate-limiting step of elongating saturated and monounsaturated fatty acids using malonyl-CoA as a two-carbon donor. ELOVL6 activity directly affects fatty acid composition in liver and adipose tissue and has been linked to insulin sensitivity, hepatic steatosis, and obesity-associated metabolic dysfunction.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.