Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human PDE3B shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX619
Species: Human
Target Gene: PDE3B
Vector System: Lentiviral
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human PDE3B shRNA Lentiviral Particle (Silencing)
SPECIFIC INQUIRY
Mammalian Cell Selection:
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX619-1 GCATCAAACTGGCAGATATAA CDS Inquiry
V0126XX619-2 TGTTGCAGAGCCCTTACTTAA 3' UTR Inquiry
V0126XX619-3 GCGTCAGCTTGGAATCTATAT CDS Inquiry
V0126XX619-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human PDE3B shRNA Lentiviral Particle (Silencing) focuses on the inhibition of phosphodiesterase 3B, which mediates the anti-lipolytic effects of insulin. By utilizing optimized U6 and miR30-based shRNA delivery, this tool assists in uncovering the mechanisms of cAMP regulation in adipose and liver cells. Every product is backed by comprehensive QC documentation, confirming sequence integrity and microbial safety, ensuring high functional titers for persistent gene knockdown experiments.
Production Cell Line: HEK293T
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.
Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.
Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.
Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.
Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.
Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.
Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.
Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: PDE3B
Full Name: Phosphodiesterase 3B
Gene Symbol: HcGIP1; cGIPDE1
Gene ID: 5140
RefSeq ID-1: NP_000913.2
RefSeq ID-2: NM_000922.3
Summary: PDE3B encodes a cyclic AMP phosphodiesterase that hydrolyzes cAMP and thereby modulates intracellular signaling pathways. It negatively regulates lipid catabolism and angiogenesis and participates in PI3K–AKT signal transduction. PDE3B is localized to membranes and functions within guanyl nucleotide exchange factor complexes. In adipocytes, PDE3B is a critical regulator of insulin-mediated suppression of lipolysis, making it highly relevant to obesity and insulin resistance.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.