Products
- Anti-Obesity Compound Library
- GPCR/G Protein-Targeted Compounds
- Immunology/Inflammation-Targeted Compounds
- JAK/STAT-Targeted Compounds
- MAPK-Targeted Compounds
- Membrane Transporter/Ion Channel-Targeted Compounds
- Metabolism-Targeted Compounds
- NF-κB-Targeted Compounds
- Microbiology/Virology-Targeted Compounds
- Neuronal Signaling-Targeted Compounds
- PI3K/Akt/mTOR-Targeted Compounds
- Oxidation-reduction-Targeted Compounds
- Proteases/Proteasome-Targeted Compounds
- Stem Cells/Wnt-Targeted Compounds
- Tyrosine Kinase/Adaptors-Targeted Compounds
- Ubiquitin-Targeted Compounds
Online Inquiry
LipoKnoxa™ Human PCSK1 shRNA Lentiviral Particle (Silencing)
Cat. No.:
V0126XX432
Species:
Human
Target Gene:
PCSK1
Vector System:
Lentiviral
Modulation Type:
Silencing (shRNA)
SPECIFIC INQUIRY
Add to basket
| Sub Cat. No. | TargetSeq | Region | Inquiry |
|---|---|---|---|
| V0126XX432-1 | AGTGGAATCACACGGACATTT | CDS | Inquiry |
| V0126XX432-2 | CTCTTACAGCAGCGGAGATTA | CDS | Inquiry |
| V0126XX432-3 | TACGGGCAAAGGAGTTGTTAT | CDS | Inquiry |
| V0126XX432-4 | Other | Inquiry |
Product Overview
Description:
LipoKnoxa™ Human PCSK1 shRNA Lentiviral Particle (Silencing) targets the proprotein convertase responsible for activating hormones like insulin and GLP-1. Engineered via our dual-strategy platform (U6 and miR30 systems), this lentiviral tool enables the stable dissection of endocrine processing defects. To ensure the highest level of biosafety, all products undergo total quality control screening, ensuring high functional titers and the absence of microbial contaminants.
Production Cell Line:
HEK293T
Promoter:
U6; CMV; EF1α; CAG; UBC
Product Availability:
Produced Upon Order
Specification
Titer Test:
qPCR
Insert Verification:
Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.
Sterility Test:
Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.
Mycoplasma Test:
Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.
Other QC:
Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.
Storage:
Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.
Stability:
Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.
Shipping Condition:
Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.
Handling Notes:
Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.
Intended Use:
This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer:
We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.
Target Profile
Gene Name:
PCSK1
Full Name:
Proprotein convertase subtilisin/kexin type 1
Gene Symbol:
PC1; PC3; NEC1; SPC3; PC1/3; BMIQ12
Gene ID:
5122
RefSeq ID-1:
NP_000430.3
RefSeq ID-2:
NM_000439.4
Summary:
The PCSK1 gene codes for a member of the subtilisin-like proprotein convertase family (PC1/3), which are essential proteases for processing hormone and neuropeptide precursors within the secretory pathway. The resulting enzyme is activated within dense core secretory granules in the neuroendocrine system and brain. This protease cleaves its substrates at specific basic residue sites, generating mature, active polypeptide hormones and neuropeptides. Mutations in PCSK1 impair this activation process, leading to severe neuroendocrine disorders and a strong association with early-onset obesity and hormonal deficiencies.