LipoKnoxa™ Human FASN shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX525-1	GCTGCTAGATGTAGGTGTTAG	3' UTR	Inquiry
V0126XX525-2	CGAGAGCACCTTTGATGACAT	CDS	Inquiry
V0126XX525-3	CCTACTGGATGCGTTCTTCAA	CDS	Inquiry
V0126XX525-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human FASN shRNA Lentiviral Particle (Silencing) targets FASN, the multi-enzyme protein catalyzing long-chain fatty acid synthesis. By utilizing high-potency U6-driven shRNA or physiologically optimized miR30 architectures, researchers can study de novo lipogenesis. Every preparation is verified via thorough QC validation, including sequence integrity and microbial safety checks.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: FASN

Full Name: Fatty acid synthase

Gene Symbol: FAS; OA-519; SDR27X1

Gene ID: 2194

RefSeq ID-1: NP_004095.4

RefSeq ID-2: NM_004104.4

Summary: FASN is the primary multi-enzyme system responsible for de novo lipogenesis. Its main task is the synthesis of palmitate from acetyl-CoA and malonyl-CoA. In a metabolic context, FASN is the machinery that converts excess energy into long-chain saturated fatty acids. While critical for normal energy storage, its dysregulation is associated with metabolic syndrome, and its fusion with other receptors has been observed in specific cancer lineages.

LipoKnoxa™ Human FASN shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products