LipoKnoxa™ Human ARL13B shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX568-1	GATATCGGGAAAGCCTATATT	CDS	Inquiry
V0126XX568-2	CATCGTAATTTGACCTAATTT	3' UTR	Inquiry
V0126XX568-3	CCGGGTAGAACCACTTAATAT	CDS	Inquiry
V0126XX568-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human ARL13B shRNA Lentiviral Particle (Silencing) targets a GTPase essential for ciliary membrane integrity. Silencing this gene using our U6 or miR30-based systems provides a robust solution for ciliary energy balance research. To ensure experimental reliability, every preparation undergoes total QC verification—covering functional titer, sequence identity, and mycoplasma testing.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: ARL13B

Full Name: ARF like GTPase 13B

Gene Symbol: JBTS8; ARL2L1

Gene ID: 200894

RefSeq ID-1: NP_001167621.1

RefSeq ID-2: NM_001174150.2

Summary: ARL13B is a small GTPase localized to the primary cilium, where it regulates ciliary formation and microtubule maintenance. As cilia are critical for sensing metabolic hormones like leptin, defects in ARL13B cause Joubert syndrome 8, a condition involving neurological deficits and potential metabolic sensing failures.

LipoKnoxa™ Human ARL13B shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products