Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human WNT10B shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX630
Species: Human
Target Gene: WNT10B
Vector System: Lentiviral
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human WNT10B shRNA Lentiviral Particle (Silencing)
SPECIFIC INQUIRY
Mammalian Cell Selection:
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX630-1 GCTCCCTCTTGTGGGATAATG 3' UTR Inquiry
V0126XX630-2 CCCTTTAACCCTGATTCATAC 3' UTR Inquiry
V0126XX630-3 TAGACACCTGAATGGACTAAG 3' UTR Inquiry
V0126XX630-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human WNT10B shRNA Lentiviral Particle (Silencing) targets a potent endogenous inhibitor of adipogenesis, facilitating the study of adipocyte differentiation control. Silencing WNT10B through our dual-strategy shRNA platform (U6 and miR30) helps researchers model increased adiposity in stable cell lines. All preparations are validated through rigorous QC processes, including functional titer measurement and negative results for pathogens (sterility and mycoplasma), ensuring repeatable data and safe long-term gene modulation.
Production Cell Line: HEK293T
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.
Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.
Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.
Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.
Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.
Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.
Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.
Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: WNT10B
Full Name: Wnt family member 10B
Gene Symbol: SHFM6; STHAG8; WNT-12
Gene ID: 7480
RefSeq ID-1: NP_003385.2
RefSeq ID-2: NM_003394.3
Summary: WNT10B encodes a secreted signaling protein of the WNT family, which regulates cell fate determination and embryonic development. WNT10B signaling acts as a molecular switch controlling adipogenesis by inhibiting adipocyte differentiation. Dysregulation of WNT10B activity can alter adipose tissue development and contribute to obesity. The protein is highly conserved, sharing 96% amino acid identity with mouse Wnt10b, and the gene is clustered with WNT1 on chromosome 12q13.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.