LipoKnoxa™ Human DYRK1B shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX450

Species: Human

Target Gene: DYRK1B

Vector System: Lentiviral

Modulation Type: Silencing (shRNA)

LipoKnoxa™ Human DYRK1B shRNA Lentiviral Particle (Silencing)

INQUIRY Datasheet MSDS

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX450-1	ACGGAGATGAAGTACTATATA	CDS	Inquiry
V0126XX450-2	ACCGCTACAGCAACCGATATT	CDS	Inquiry
V0126XX450-3	CACGGAGATGAAGTACTATAT	CDS	Inquiry
V0126XX450-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human DYRK1B shRNA Lentiviral Particle (Silencing) targets the DYRK1B kinase, which is associated with abdominal obesity and metabolic syndrome. Engineered via our dual-strategy platform (U6 and miR30 systems), this lentiviral tool allows for the exploration of kinase-dependent pathways in adipogenesis. To guarantee experimental success, every preparation undergoes total QC verification—covering functional titer, sequence accuracy, and sterility.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: DYRK1B

Full Name: Dual specificity tyrosine phosphorylation regulated kinase 1B

Gene Symbol: MIRK; AOMS3

Gene ID: 9149

RefSeq ID-1: NP_004705.1

RefSeq ID-2: NM_004714.3

Summary: DYRK1B encodes a member of a nuclear-localized protein kinase family (DYRK). This enzyme participates in the critical regulation of the cell cycle and is involved in various signaling cascades. While its expression can be altered in certain tumor cells, its most notable clinical significance lies in metabolism: mutations in DYRK1B have been identified as a cause of Abdominal Obesity-Metabolic Syndrome 3. This links the kinase's role in cellular proliferation and differentiation directly to the development of central obesity and associated metabolic dysfunctions.

Related Products

Inquiry

Inquiry Basket

Delete selected Check Out