Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human MAGEL2 shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX478
Species: Human
Target Gene: MAGEL2
Vector System: Lentiviral
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human MAGEL2 shRNA Lentiviral Particle (Silencing)
SPECIFIC INQUIRY
Mammalian Cell Selection:
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX478-1 CGCCTATATTATCATCAACAA CDS Inquiry
V0126XX478-2 GCCCAATATGAATGCCTCAAA CDS Inquiry
V0126XX478-3 CGAAGTGTTTGTCAGGCAGAA CDS Inquiry
V0126XX478-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human MAGEL2 shRNA Lentiviral Particle (Silencing) targets the gene linked to Prader-Willi syndrome, which involves severe hyperphagia and obesity. By utilizing high-potency U6-driven shRNA or physiologically optimized miR30 architectures, researchers can study hypothalamic protein recycling and satiety defects. Each preparation is verified via thorough QC validation, including sequence integrity and sterility testing, to ensure reliability.
Production Cell Line: HEK293T
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.
Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.
Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.
Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.
Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.
Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.
Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.
Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: MAGEL2
Full Name: MAGE family member L2
Gene Symbol: PWLS; nM15; NDNL1; SHFYNG
Gene ID: 54551
RefSeq ID-1: NP_061939.3
RefSeq ID-2: NM_019066.5
Summary: MAGEL2 is located within the chromosomal region associated with Prader-Willi syndrome (PWS) (15q11-q13). PWS is caused by the loss of expression of paternally inherited imprinted genes in this region, leading to a phenotype marked by neonatal hypotonia, developmental delay, and childhood-onset morbid obesity. MAGEL2 is structurally similar to Necdin (NDN), another gene implicated in PWS etiology, and is also paternally imprinted. Its localization and structure strongly suggest that MAGEL2 plays a necessary role in the development of the PWS phenotype, particularly the neuroendocrine dysfunction leading to hyperphagia and obesity.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.