LipoKnoxa™ Human LPIN2 shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX566-1	CGGCAGCACAACTTCATATAA	CDS	Inquiry
V0126XX566-2	CCCAGCTTAAATAGTTGATAA	3' UTR	Inquiry
V0126XX566-3	TCCTAGGACAGCTACAATTAC	CDS	Inquiry
V0126XX566-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human LPIN2 shRNA Lentiviral Particle (Silencing) targets lipin-2, involved in lipid metabolism and inflammatory signaling. Our RNAi platform develops this tool with both U6 and miR30 systems to provide either maximal or regulated knockdown. Each preparation is verified via thorough QC validation—including sequence integrity and microbial safety checks.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: LPIN2

Full Name: Lipin 2

Gene Symbol: MJDS; CRMO1

Gene ID: 9663

RefSeq ID-1: NP_001362737.1

RefSeq ID-2: NM_001375808.2

Summary: LPIN2 belongs to the lipin family and is essential for normal triglyceride metabolism and the healthy development of adipose tissue. It is a major candidate gene for lipodystrophy in humans. Deficiencies in LPIN2 activity result in a failure to store fat properly in adipocytes, leading to secondary complications like fatty liver and insulin resistance.

LipoKnoxa™ Human LPIN2 shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products