LipoKnoxa™ Human FABP2 shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX521-1	TGGAGCCTTGAGGGAAATAAA	CDS	Inquiry
V0126XX521-2	CTATATTGTACCAGAACTATT	3' UTR	Inquiry
V0126XX521-3	GCTAGGACTATGGGTACATTC	3' UTR	Inquiry
V0126XX521-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human FABP2 shRNA Lentiviral Particle (Silencing) targets FABP2 to study its role in dietary lipid uptake. Developed using optimized U6 and miR30-based shRNA systems, this tool enables researchers to investigate intestinal fat absorption. Every batch is verified through a comprehensive QC suite—including functional titer, sequence accuracy, and sterility.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: FABP2

Full Name: Fatty acid binding protein 2

Gene Symbol: FABPI; I-FABP

Gene ID: 2169

RefSeq ID-1: NP_000125.2

RefSeq ID-2: NM_000134.4

Summary: FABP2 is a critical intracellular carrier responsible for the uptake and trafficking of long-chain fatty acids, particularly within the intestinal epithelium. It exhibits a high affinity for saturated fatty acids, serving not only as a transporter but also as a lipid sensor that helps the body modulate energy balance. Beyond fat metabolism, the protein influences cell growth patterns. Variations in FABP2 are often studied for their impact on dietary fat absorption efficiency and their subsequent link to obesity.

LipoKnoxa™ Human FABP2 shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products