LipoKnoxa™ Human PPARA shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX503-1	TGTAGGTAACCGGCATATTAT	3' UTR	Inquiry
V0126XX503-2	GCGTATGGAAATGGGTTTATA	CDS	Inquiry
V0126XX503-3	GCTTTACGGAATACCAGTATT	CDS	Inquiry
V0126XX503-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human PPARA shRNA Lentiviral Particle (Silencing) is specifically developed to suppress PPAR-alpha, the master regulator of fatty acid oxidation. By utilizing either deep-silencing U6-driven shRNA or cell-type-specific miR30-based shRNA, researchers can model lipid accumulation. Every batch is validated through total quality control screening—including functional titer and sterility—to guarantee the highest level of biosafety.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: PPARA

Full Name: Peroxisome proliferator activated receptor alpha

Gene Symbol: PPAR; NR1C1; hPPAR; PPARalpha; PPAR-alpha

Gene ID: 5465

RefSeq ID-1: NP_001001928.1

RefSeq ID-2: NM_001001928.4

Summary: PPARA encodes peroxisome proliferator-activated receptor alpha, a nuclear receptor that regulates genes involved in lipid metabolism, cell differentiation, proliferation, and immune responses. PPARα is activated by peroxisome proliferators, including hypolipidemic drugs, herbicides, and leukotriene antagonists. Several transcript variants have been reported, with two full-length isoforms fully characterized.

LipoKnoxa™ Human PPARA shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products