LipoKnoxa™ Human TRIP12 shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX623-1	GTATCTAAGACTGGTTATATT	CDS	Inquiry
V0126XX623-2	GTAGGCCTGATCATGGTTATA	CDS	Inquiry
V0126XX623-3	TATCAGTCGATACTGGTATTA	CDS	Inquiry
V0126XX623-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human TRIP12 shRNA Lentiviral Particle (Silencing) targets an E3 ubiquitin ligase involved in protein turnover and energy metabolism. Engineered with both U6 and miR30-based shRNA architectures, this tool allows for the exploration of protein degradation pathways in metabolic health. Every preparation is verified through thorough QC validation—including sequence integrity and microbial purity checks—ensuring that results are safe, reproducible, and scientifically robust.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: TRIP12

Full Name: Thyroid hormone receptor interactor 12

Gene Symbol: ULF; MRD49; TRIPC; TRIP-12

Gene ID: 9320

RefSeq ID-1: NP_001271143.1

RefSeq ID-2: NM_001284214.2

Summary: TRIP12 encodes an E3 ubiquitin ligase that targets the tumor suppressor p19ARF for degradation and regulates DNA damage responses by controlling USP7 stability and p53 signaling. Although primarily studied in cancer biology, ubiquitin-mediated protein turnover regulated by TRIP12 may influence adipocyte differentiation and metabolic stress responses, processes relevant to obesity and energy balance.

LipoKnoxa™ Human TRIP12 shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products