LipoKnoxa™ Human PHF21A shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX614

Species: Human

Target Gene: PHF21A

Vector System: Lentiviral

Modulation Type: Silencing (shRNA)

LipoKnoxa™ Human PHF21A shRNA Lentiviral Particle (Silencing)

INQUIRY Datasheet MSDS

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX614-1	CTAAACTTTCGCTACTATAAA	3' UTR	Inquiry
V0126XX614-2	ACGGAAGAACCTGATAGTAAA	CDS	Inquiry
V0126XX614-3	GCCCAGAATAACATTCCTATT	CDS	Inquiry
V0126XX614-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human PHF21A shRNA Lentiviral Particle (Silencing) targets a histone-binding protein involved in epigenetic regulation and associated with obesity-related developmental phenotypes. Our RNAi platform develops this product with both U6 and miR30 systems to investigate gene silencing at the chromatin level. Every batch is verified through a comprehensive QC suite—including functional titer, sequence accuracy, and sterility testing—ensuring repeatable and safe results in epigenetic studies.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: PHF21A

Full Name: PHD finger protein 21A

Gene Symbol: BHC80; NEDMS; BM-006; IDDBCS

Gene ID: 51317

RefSeq ID-1: NP_001095272.1

RefSeq ID-2: NM_001101802.3

Summary: PHF21A encodes BHC80, a component of the BRAF35/histone deacetylase (HDAC) repressor complex that suppresses neuron-specific gene expression through the repressor element-1 (RE1), also known as the neural restrictive silencer (NRS). While primarily studied in neurodevelopmental regulation, emerging evidence suggests that epigenetic repression mechanisms mediated by PHF21A may influence hypothalamic pathways controlling appetite, energy balance, and body weight. Altered chromatin regulation in neuronal circuits is increasingly recognized as a contributor to obesity susceptibility.

Related Products

Inquiry

Inquiry Basket

Delete selected Check Out