Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human LZTFL1 shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX493
Species: Human
Target Gene: LZTFL1
Vector System: Lentiviral
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human LZTFL1 shRNA Lentiviral Particle (Silencing)
SPECIFIC INQUIRY
Mammalian Cell Selection:
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX493-1 TTAGAACTAGAGTTCCTATTT 3' UTR Inquiry
V0126XX493-2 TGGAACAGCAGAACTCCTAAA CDS Inquiry
V0126XX493-3 GCCTATACCAATGTGTTACTT CDS Inquiry
V0126XX493-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human LZTFL1 shRNA Lentiviral Particle (Silencing) provides a robust solution for silencing the LZTFL1, which is implicated in ciliary protein trafficking and syndromic obesity. Developed using specialized U6 or miR30-based shRNA delivery, this tool assists in uncovering the pathways of ciliary-mediated energy balance. Each preparation is backed by exhaustive QC documentation, confirming sequence integrity and sterility for safe ex vivo and in vitro applications.
Production Cell Line: HEK293T
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.
Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.
Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.
Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.
Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.
Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.
Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.
Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: LZTFL1
Full Name: Leucine zipper transcription factor like 1
Gene Symbol: BBS17
Gene ID: 54585
RefSeq ID-1: NP_001263307.1
RefSeq ID-2: NM_001276378.2
Summary: LZTFL1 encodes a cytoplasmic protein that interacts with Bardet–Biedl syndrome (BBS) proteins to control ciliary membrane protein trafficking. Nonsense mutations cause a form of BBS, a ciliopathy characterized by obesity, polydactyly, cognitive deficits, hypogonadism, and kidney dysfunction. LZTFL1 may also act as a tumor suppressor by modulating E-cadherin and actin cytoskeleton dynamics.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.