LipoKnoxa™ Human CPT1A shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX517-1	GCGTTCTTCGTGACGTTAGAT	CDS	Inquiry
V0126XX517-2	CGATGTTACGACAGGTGGTTT	CDS	Inquiry
V0126XX517-3	CGTAGCCTTTGGTAAAGGAAT	CDS	Inquiry
V0126XX517-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human CPT1A shRNA Lentiviral Particle (Silencing) targets the liver isoform of CPT1A, essential for fatty acid oxidation. Silencing CPT1A via our advanced RNAi platform (U6 or miR30-based) allows for the investigation of lipid burning. Every batch is validated through stringent QC processes, including functional titer measurement and sterility testing.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: CPT1A

Full Name: Carnitine palmitoyltransferase 1A

Gene Symbol: CPT1; CPT I; CPT1-L; CPTI-L; L-CPT1

Gene ID: 1374

RefSeq ID-1: NP_001027017.1

RefSeq ID-2: NM_001031847.3

Summary: CPT1A is the "gatekeeper" for mitochondrial fatty acid oxidation. Located on the outer mitochondrial membrane, it facilitates the carnitine-dependent transport of long-chain fatty acids into the mitochondria for energy production. A deficiency in CPT1A activity severely limits the body's ability to utilize stored fat for fuel, a mechanism frequently disrupted in chronic obesity.

LipoKnoxa™ Human CPT1A shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products