LipoKnoxa™ Human ADIPOR1 shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX531-1	GCCCACCATGCACTTTACTAT	CDS	Inquiry
V0126XX531-2	CTGCTTGGTTTCGTGCTGTTT	CDS	Inquiry
V0126XX531-3	CGTCTATTGTCATTCAGAGAA	CDS	Inquiry
V0126XX531-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human ADIPOR1 shRNA Lentiviral Particle (Silencing) targets adiponectin receptor 1, facilitating the investigation of fatty acid oxidation in stable cell models. Our system provides high-potency U6-driven shRNA and physiologically optimized miR30-based shRNA for improved biosafety. To ensure experimental reliability, every preparation undergoes total QC verification—including functional titer, sequence identity, and sterility.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: ADIPOR1

Full Name: Adiponectin receptor 1

Gene Symbol: CGI45; PAQR1; ACDCR1; CGI-45; TESBP1A

Gene ID: 51094

RefSeq ID-1: NP_001277482.1

RefSeq ID-2: NM_001290553.2

Summary: ADIPOR1 encodes an adiponectin-responsive receptor that mediates key metabolic actions of this adipocyte-derived hormone. Upon ligand binding, ADIPOR1 activates AMPK-dependent signaling cascades that enhance fatty acid oxidation and improve insulin responsiveness. Through these mechanisms, ADIPOR1 contributes to the regulation of systemic energy balance and obesity-related metabolic traits.

LipoKnoxa™ Human ADIPOR1 shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products