Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human LIPC shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX480
Species: Human
Target Gene: LIPC
Vector System: Lentiviral
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human LIPC shRNA Lentiviral Particle (Silencing)
SPECIFIC INQUIRY
Mammalian Cell Selection:
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX480-1 CGAAGCCATGTTCACCTAATT CDS Inquiry
V0126XX480-2 GCATGAGATGAAGACCAGATT CDS Inquiry
V0126XX480-3 CCATGTCACTACTCGGAACAA CDS Inquiry
V0126XX480-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human LIPC shRNA Lentiviral Particle (Silencing) targets LIPC, a major regulator of HDL and LDL particle remodeling. Utilizing an advanced RNAi platform with optimized U6 or miR30-based shRNA delivery, this tool helps researchers understand the mechanisms of dyslipidemia. Every preparation undergoes total QC verification, including high-precision titering and microbial contaminants screening, ensuring data accuracy and safety.
Production Cell Line: HEK293T
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.
Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.
Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.
Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.
Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.
Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.
Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.
Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: LIPC
Full Name: Lipase C, hepatic type
Gene Symbol: HL; HTGL; LIPH; HDLCQ12
Gene ID: 3990
RefSeq ID-1: NP_000227.2
RefSeq ID-2: NM_000236.3
Summary: LIPC encodes Hepatic Lipase (HL), an enzyme with both phospholipase A1 and triacylglycerol lipase activity. This enzyme is located in the extracellular space, primarily on the surface of the liver and in the blood, where it plays a critical role in plasma lipoprotein particle remodeling and the catabolism of triglycerides and phospholipids. HL is central to cholesterol homeostasis by converting intermediate density lipoproteins (IDL) to low density lipoproteins (LDL). Abnormal LIPC activity is implicated in diseases like coronary artery disease and Type 2 diabetes, and it is a known biomarker of obesity and hyperinsulinism.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.