LipoKnoxa™ Human CRP shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX463

Species: Human

Target Gene: CRP

Vector System: Lentiviral

Modulation Type: Silencing (shRNA)

LipoKnoxa™ Human CRP shRNA Lentiviral Particle (Silencing)

INQUIRY Datasheet MSDS

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX463-1	GCGCTGATCTTCTATTTAATT	3' UTR	Inquiry
V0126XX463-2	CAGTAGCTCCAGTACACATTT	CDS	Inquiry
V0126XX463-3	TCGACCCGTGGGTACAGTATT	CDS	Inquiry
V0126XX463-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human CRP shRNA Lentiviral Particle (Silencing) is engineered for the long-term suppression of CRP, a major clinical marker for systemic inflammation and cardiovascular risk. Utilizing an advanced RNAi framework that includes both U6 and miR30-based systems, researchers can effectively study the inflammatory drivers of obesity. Our customizable lentiviral system supports flexible reporter gene inclusion and maintains strict quality control oversight covering sequence accuracy and functional titering.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: CRP

Full Name: C-reactive protein

Gene Symbol: PTX1

Gene ID: 1401

RefSeq ID-1: NP_000558.2

RefSeq ID-2: NM_000567.3

Summary: CRP encodes a pentraxin family protein involved in complement activation and regulation through interactions with pattern recognition molecules and complement regulators. The protein contains a calcium-dependent ligand-binding domain with a flattened beta-jellyroll structure and exists as a pentamer in circulation or a monomer in tissues. CRP contributes to host defense by recognizing pathogens and damaged cells and initiating their clearance via humoral and cellular mechanisms. Plasma CRP levels increase dramatically during acute-phase responses to infection, tissue injury, or inflammation. Chronic elevation of CRP has been linked to adult-onset obesity.

Related Products

Inquiry

Inquiry Basket

Delete selected Check Out